Search results

assimilate lactose and convert it into lactic acid. Kluyveromyces lactis (formerly Saccharomyces lactis) is a yeast which has the ability to assimilate lactose...

mutants. Kluyveromyces is widely cultured for microbiological en genetic research. Some important species include: Kluyveromyces lactis Kluyveromyces marxianus...

Kluyveromyces marxianus in ascomycetous yeast and member of the genus, Kluyveromyces. It is the sexual stage of Atelosaccharomyces pseudotropicalis [citation...

the K28 toxin by forming a complex with it. Killer properties of Kluyveromyces lactis are associated with linear DNA plasmids, which have on their 5'end...

Debaryomyces hansenii and its non-sporulating form Candida famata, and Kluyveromyces lactis and its non-sporulating form Candida sphaerica. Similarly to other...

strains of yeast that can metabolize lactose, such as Kluyveromyces marxianus, Kluyveromyces lactis, and Saccharomyces fragilis, as well as strains of yeast...

oxygen. If oxygen is present, some species of yeast (e.g., Kluyveromyces lactis or Kluyveromyces lipolytica) will oxidize pyruvate completely to carbon dioxide...

commercially can be extracted both from yeasts such as Kluyveromyces fragilis and Kluyveromyces lactis and from molds, such as Aspergillus niger and Aspergillus...

recombinantly in Escherichia coli, Aspergillus niger var. awamori, and Kluyveromyces lactis.[citation needed] Chymosin is found in a wide range of tetrapods...

Sträter, Norbert (2010). "Crystal Structure of Hexokinase KlHxk1 of Kluyveromyces lactis". Journal of Biological Chemistry. 285 (52). Elsevier BV: 41019–41033...

Caenorhabditis elegans" "Saccharomyces cerevisiae, Schizosaccharomyces pombe, Kluyveromyces lactis, Eremothecium gossypii, Magnaporthe grisea, Neurospora crassa" "Arabidopsis...

substrates; it is thermo-tolerant and can assimilate nitrate (see also Kluyveromyces lactis). It has been applied to the production of hepatitis B vaccines,...

"Undd Bertholetus praeparat ex sero lactis remedium, quod vocat mannam S. [alchemical symbol for salt, salem] seri lactis vid. in Encyclopaed. p. 400. Praeparatio...

trademark CHY-MAX by the Danish company Chr. Hansen, or produced by Kluyveromyces lactis and commercialized under the trademark Maxiren by the Dutch company...

GGTGTACGGATGCAGACTCGCTT Candida guillermondii GGTGTAC Candida pseudotropicalis GGTGTACGGATTTGATTAGTTATGT Kluyveromyces lactis GGTGTACGGATTTGATTAGGTATGT...

used for genetic engineering of yeast—and linear pGKL plasmids from Kluyveromyces lactis, that are responsible for killer phenotypes. Other types of plasmids...

2012). "Functional analysis of the single Est1/Ebs1 homologue in Kluyveromyces lactis reveals roles in both telomere maintenance and rapamycin resistance"...

produced in yeast. Another yeast used for protein production is Kluyveromyces lactis and the gene is expressed, driven by a variant of the strong lactase...

which includes chitinase, chitodextrinase and the killer toxin of Kluyveromyces lactis. The chitinases hydrolyse chitin oligosaccharides. Another chitinase...

/genomes/refseq/fungi/Kluyveromyces_lactis/latest_assembly_versions/GCF_000002515.2_ASM251v1". ftp.ncbi.nih.gov. Retrieved 2020-12-31. "Kluyveromyces lactis (ID 193)...